Genetika‎ > ‎

***Úlohy z genetiky

Tento dokument k dispozici i ve formátu PDF.
(Ke stažení v přílohách na konci stránky).

Zpracováno podle

Molekulární genetika, mutace

1)             Napište komplementární řetězec k uvedenému řetězci DNA:
            5´ CGTACGGTTCGATGCACTGTACTGC 3´.

2)             Napište sekvenci vlákna mRNA vzniklé transkripcí molekuly DNA, pokud templátem bude sekvence daná v předchozí úloze (CGT…TGC).

3)             V sekvenci mRNA z úlohy 2) najděte iniciační kodón a kodón signalizující ukončení transkripce. Dále napište pořadí aminokyselin v peptidovém řetězci, který vznikne translací této mRNA.

4)             Pokud je v daném úseku molekuly DNA 287 A a 351 C, kolik tam bude ostatních bází? Kolik tam bude purinů a kolik pyrimidinů?

5)             V prvním řádku je sekvence normální alely, ve druhém potom sekvence alely mutované. Určete, o jakou mutaci se jedná:

a)      TGT GTA ATA CCG GGT TTG ACC
      TGT TTA ATA CCG GGT TTG ACC

b)      TGT GTA ATA CCG GGT TTG ACC
      TGT GTA ATA CGG GTT TGA CC

c)      TGT GTA ATA CCG GGT TTG ACC
      TGT GTA ATA GGT TTG ACC

d)      TGT GTA ATA CCG GGT TTG ACC
      TGT GTA ATA CCG GGT ATT GAC C

Mendelismus

6)             Chovatelé králíků vyšlechtili lysého mutanta. Alela s, kterou je tato odchylka ve vytváření srsti dědičně založena, je recesivní, kdežto dominantní alele S odpovídá normální typ srsti.

a)      Bylo kříženo 30 samic s normální srstí s 30 lysými samci. V potomstvu bylo 73 samců a 73 samic s normální srstí (F1). Jejich vzájemným křížením bylo získáno v F2 generaci 216 králíků – z toho 160 s normální srstí a 56 lysých. Určete genotypy rodičů a potomků v F1 a F2.

b)      Křížením 23 lysých samic s 23 samci s normální srstí získali 87 potomků s normální srstí. Z nich vybrali 23 samců, které zpětně křížili s rodičovskými samicemi: 28 králíků mělo normální srst a 31 bylo lysých. Vysvětlete zjištěné štěpné poměry.

7)             Dvě slepice s růžicovitým tvarem hřebínku byly kříženy s kohoutem s normálním hřebínkem. První slepice měla všechna kuřata s růžicovitým hřebínkem, druhá polovičku s růžicovitým, polovičku s normálním hřebínkem. Jaká je dědičnost tvaru hřebene u slepic?

8)             U hrachu odpovídá za kulovitý tvar semen úplně dominantní alela R, recesivní alela r podmiňuje svraskalý tvar semene. Úplně dominantní alela L určuje žlutou barvu semene, zelenou potom recesivní alela l.

a)      Po křížení rostliny vyrostlé ze zeleného kulovitého semene s rostlinou vyrostlou ze semene žlutého svraskalého byla získána semena čtyř fenotypových kategorií. Určete genotypy rodičů a potomstva.

b)      Po křížení rostliny vyrostlé ze zeleného svraskalého semene s rostlinou vyrostlou ze semene žlutého kulovitého byla získána semena pouze žlutá, avšak jedna polovina byla kulovitých, druhá polovina svraskalých. Určete genotypy rodičů a potomstva.

c)      Dvě rostliny vyrostlé ze žlutých svraskalých semen byly kříženy s rostlinou vyrostlou ze zeleného kulovitého semene. V luscích první rostliny byla semena pouze žlutá, štěpící ve tvaru semen. V luscích druhé rostliny byla semena čtyř fenotypových kategorií. Určete genotypy rodičů a potomstva.

9)             Určete pravděpodobnost vzniku potomka daného genotypu v uvedených kříženích:

a)      AaBbDDrr × aaBbDdRr … P(aaBbDDRr), P(AaBBDdrr), P(Aabbdd Rr)

b)      AaBBDdRr × AaBbDdRr … P(AABbDDRR), P(AABBDDrr), P(aaBBDDRr)

10)         Kolik různých gamet tvoří jedinci uvedených genotypů?

a)      DdRRBbnn

b)      NNRrKkBbffSs

c)      NNDdwwJJ

d)      DdrrKkUUNnYy

Genové interakce

11)         Jakými genovými interakcemi jsou podmíněny tyto štěpné poměry:

a)      162 : 44 : 15

b)      259 : 92 : 114

c)      179 : 135

d)      257 : 63

12)         U papriky podmiňuje úplně dominantní alela R syntézu červeného barviva v plodu. Úplně dominantní alela Cl odpovídá za rozpad chlorofylu u plodu v plné zralosti. Recesivní homozygoti v obou sledovaných genech mají plody zelené, dominantní homozygoti tvoří plody červené. Dalšími fenotypovými kategoriemi je zbarvení hnědé (syntéza červeného barviva bez rozpadu chlorofylu) a žluté (neschopnost syntézy červeného barviva a současný rozpad chlorofylu).

a)      Křížením rostlin s hnědými plody s rostlinami se žlutými plody bylo získáno 36 rostlin s červenými a 31 rostlin s hnědými plody. Určete genotypy rodičů.

b)      S jakou pravděpodobností vyštěpí v následující generaci po křížení takto vzniklých červenoplodých a hnědoplodých rostlin aa) rostliny s plody žlutými, bb) rostliny s plody hnědými.

13)         U některých odrůd cibule podmiňuje alela C schopnost vytvořit barvivo ve slupce. Rostliny genotypu C-rr syntetizují žluté barvivo, rostliny s genotypem C-R- červené barvivo. U rostlin genotypu cc je slupka bílá. Křížením homozygotní rostliny s bílou slupkou s homozygotní rostlinou s červenou slupkou bylo získáno uniformní potomstvo s červenými slupkami. V generaci F2 byl zjištěn štěpný poměr blízký poměru 9/16 červených : 3/16 žlutých : 4/16 bílých.

a)      Určete genotypy parentální a F1 generace.

b)      O jaký typ genové interakce se jedná?

14)         Společná přítomnost dominantních alel L a H v genotypu je u jetele plazivého podmínkou syntézy kyanovodíku.

a)      Určete genotypy rodičů neschopných tvořit kyanovodík, jejichž společné uniformní potomstvo kyanovodík tvoří.

b)      Odvoďte štěpný poměr v F2 generaci.

c)      O jaký typ genové interakce se jedná?

15)         U slepic podmiňují dominantní alely R hřeben růžicovitý a P hřeben hráškovitý. Jsou-li přítomny v genomu obě společně, je hřeben ořechovitý. Jedinci dvojnásobně recesivní mají hřeben jednoduchý. Provedeme tři křížení:

a)      Rr Pp × Rr Pp   Který fenotyp bude nejméně četný?

b)      RR Pp × rr Pp   Bude v potomstvu jedinec s hráškovitým hřebenem?

c)      rr PP × Rr Pp   Bude v potomstvu jedinec s ořechovitým hřebenem?

Vazba genů

16)         Z výsledků zpětného analytického křížení vyjádřete sílu vazby hodnotami c a p a určete vazbovou fázi:

a)      283 : 62 : 68 : 265

b)      26 : 126 : 115 : 22

17)         U rajčat je okrouhlý tvar plodu O dominantní nad protáhlým o a hladký povrch plodu P nad broskvovým p. Testovací zpětná křížení jedinců F1 heterozygotních v těchto alelových párech dala tyto výsledky: 12 hladkých okrouhlých, 123 hladkých protáhlých, 133 broskvových okrouhlých, 12 broskvových protáhlých.

a)      Jsou sledované alelové páry nezávisle kombinovány, nebo jsou ve vazbě?

b)      V případě jejich vazby určete, zda byly sledované alelové páry v F1 vázány ve fázi cis nebo trans.

c)      V případě vazby vypočítejte procento rekombinace a Batesonovo číslo.

18)         Geny A a B leží na 2. chromosomu, vzdálenost mezi nimi je 10 cM. Geny C a D jsou vázány silou 20 cM a jsou lokalizovány na 3. chromosomu. Křížíme rostliny AABBCCDD × aabbccdd. Určete štěpný poměr v B1 generaci.

19)         Určete fenotypový štěpný poměr v B1 generaci. Víte, že heterozygot je potomkem po křížení dvou homozygotních rostlin rajčete: rostlina A – vysoká lodyha V, kulatý plod K, červený plod C a rostlina B – nízká lodyha, oválné, žluté plody. Geny V a K jsou ve vazbě, leží ve vzdálenosti 20 cM. Gen C je volně kombinovatelný.

20)         Určete správné pořadí genů na chromosomu, vzdálenosti mezi geny a koeficient koincidence. Křížení: RrSsTt × rrsstt. Potomci: RST 88, rST 355, RSt 21, rSt 2, RsT 2, rsT 17, Rst 339, rst 55.

Dědičnost a pohlaví

21)         U koček podmiňuje alela B žlutou barvu srsti, alela B černou barvu. Heterozygoti jsou žíhaní. Gen B je lokalizován v nehomologické části chromosomu X. Jaká bude barva srsti potomků z následujících křížení:

a)      černý kocour × žlutá kočka

b)      černý kocour × žíhaná kočka

c)      žlutý kocour × žíhaná kočka

22)         U kura domácího je alela pro žíhané zbarvení peří (B) dominantní nad alelou odpovídající za hnědé nebo černé zbarvení bez žíhání (b). Gen pro zbarvení peří je lokalizován v nehomologické části pohlavního chromosomu Z. Určete fenotypový štěpný poměr v potomstvech těchto křížení:

a)      hnědý kohout × žíhaná slepice

b)      čistokrevný žíhaný kohout × hnědá slepice

c)      žíhaný hybridní kohout × hnědá slepice

23)         U octomilky existuje na druhém chromozomu recesivní alela vg (vestigial) podmiňující zakrnělá křídla. Recesivní alela w (white) jiného genu, lokalizovaného v nehomologickém úseku chromozomu X, podmiňuje bílé zbarvení očí. Zkřížíme homozygotní bělookou samičku s normálními křídly s homozygotním červenookým samečkem se zakrnělými křídly. Vzniknou v potomstvu po zpětném křížení samičky F1 s červenookým otcem se zakrnělými křídly:

a)      červenoocí samečci se zakrnělými křídly

b)      bělooké samičky s normálními křídly

24)         Barvoslepost pro černou a zelenou barvu u člověka je podmíněna recesivní alelou c genu úplně vázaného na chromozom X. Normálně vidící žena, jejíž otec byl barvoslepý, se provdala za barvoslepého muže.

a)      Jaký byl genotyp zmíněné ženy?

b)      Jaká je pravděpodobnost, že její první dítě bude barvoslepý syn?

c)      Jaká část dětí z tohoto manželství (bez ohledu na pohlaví) by byla normálně vidící?

d)      Jaká je pravděpodobnost výskytu barvosleposti mezi dcerami?

25)         Plešatost je u člověka znak pohlavně ovlivněný. U muže je předčasná plešatost podmíněna dominantní alelou P. K tomu, aby se vyskytla plešatost u ženy, musí být alela P v homozygotním stavu (PP). U muže se plešatost projevuje i v heterozygotním stavu (Pp). Plešatý muž, jehož otec měl normální vlasy, se ožení s ženou s normálními vlasy, jejíž matka a všichni bratři byli plešatí. Jaké děti se mohou narodit v tomto manželství?

Genetika populací

26)         Je-li 40 % pšenice na poli heterozygotních v určitém páru alel, jaký bude podíl homozygotů a heterozygotů v populaci po dvou generacích samosprášení?

27)         Thalasemie, zhoubná anémie, se vyskytuje také v poměrně uzavřené jihoitalské přistěhovalecké populaci v USA. U kolika příslušníků této populace (v %) je třeba předpokládat lehkou formu onemocnění (genotyp Tt), jestliže na těžkou formu (tt) umírají 4 % novorozenců?

28)         Albinismus je autozomálně recesivní defekt syntézy melaninu. V populaci se vyskytuje průměrně jeden albín na deset tisíc obyvatel. Vypočítejte a) frekvenci alely pro albinismus a b) frekvenci heterozygotů v populaci.

29)         V populaci jsou průměrně dva muži postiženi hemofilií na deset tisíc zdravých mužů. Určete a) frekvenci žen přenašeček a b) frekvenci postižených žen.

30)         Určete frekvenci alely pro brachydaktylii (autozomálně dominantní choroba) v populaci, ve které je výskyt tohoto defektu 1 : 10000.


ŘEŠENÍ

1)             3´ GCATGCCAAGCTACGTGACATGACG 5´

2)             GCAUGCCAAGCUACGUGACAUGACG

3)             GCAUGCCAAGCUACGUGACAUGACG; Met-Pro-Ser-Tyr-Val-Thr

4)             287 T, 351 G; 638 purinů (A, G), 638 pyrimidinů (C, T)

5)             a) substituce
         b) delece s posunem čtecího rámce
         c) delece celého tripletu bez posunu čtecího rámce
         d) inzerce s posunem čtecího rámce

6)             a) P: SS, ss   F1: Ss   F2: SS, Ss, ss
         b) P: ss, SS   F1: Ss   B1: Ss, ss

7)             růžicovitý hřebínek je dominantní nad normálním

8)             a) llRr × Llrr; LlRr, Llrr, llRr, llrr
         b) llrr × LLRr; LlRr, Llrr
         c) 1. rostlina LLrr × llRr; LlRr, Llrr, 2. rostlina Llrr × llRr; LlRr, Llrr, llRr, llrr

9)             a) 1/16, 1/32, 0
         b) 1/128, 1/128, 1/64

10)         a) 4, b) 16, c) 2, d) 16

11)         a) dominantní epistáze, b) recesivní epistáze, c) komplementace, d) inhibice

12)         a) RRclcl, rrClcl, b) aa) 1/8, bb) 3/8

13)         a) P: ccrr, CCRR   F1: CcRr, b) recesivní epistáze

14)         a) LLhh, llHH, b) 9 : 7, c) komplementace

15)         a) jednoduchý, b) ne, c) ano

16)         a) c = 4,22, p = 0,192 (19,2 cM), cis
         b) c = 5,02, p = 0,166 (16,6 cM), trans

17)         a) jsou ve vazbě, b) trans, c) 8,6 %, c = 10,67

18)         (9 : 1 : 1 : 9) × (4 : 1 : 1 : 4)

19)         v B1 8 fenotypů (4 VK : 1 Vk : 1 vK : 4 vk) × (1 C : 1 c)

20)         pořadí: R-T-S; vzdálenosti 16,7 cM a 4,8 cM; KK = 0,58

21)         a) kocouři žlutí, kočky žíhané, b) kocouři žlutí a černí, kočky žíhané, c) kocouři žlutí a černí, kočky žluté a žíhané

22)         a) slepice tmavé, kohouti žíhaní, b) slepice i kohouti žíhaní, c) slepice i kohouti žíhaní i tmaví (1 : 1)

23)         a) ano, b) ne

24)         a) XCXc, b) 25 %, c) 50 %, d) 50 %

25)         plešatost u synů: P = ¾, u dcer P = ¼

26)         90 % homozygotů, 10 % heterozygotů

27)         32 %

28)         a) 0,01, b) 0,0198

29)         a) 4 × 10–4, b) 4 × 10–8

30)         5 × 10–5

Ċ
Tomáš Macháček,
25. 12. 2009 10:07
Comments